View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784-Insertion-13 (Length: 279)
Name: NF0784-Insertion-13
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784-Insertion-13 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 7 - 279
Target Start/End: Original strand, 46754440 - 46754709
Alignment:
Q |
7 |
aaaaaatctataaagtatatagatgagagatgtgtgatgattaaaattacggtggtgccctttcctttgtctgcagatattttatcccatgtgttttttg |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46754440 |
aaaaaatctataaagtatatagatgagagatgtgtgatgagtaaaattacggtggtgccctttcctttgtctgcagatattttatcccatgtgttttttg |
46754539 |
T |
 |
Q |
107 |
tttcttcctcatcagaacatactgactctagcatgtgaggtttggtttggttcttggacaaaagtgtcttttgccgattgtaatgtggttattatcatca |
206 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
46754540 |
tttcttcctcatcagaacatactgactctagcatgtgaggtttggtttggttcttggacaaaagtgtcttttgccgattgtaatgtggttatt---atca |
46754636 |
T |
 |
Q |
207 |
tcataggagagtaaatcattagatggctaacaatttgctagacaggtgctttgacttgtgtatgttgtgtata |
279 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46754637 |
tcataggagagtaaatcagtagatggctaacaatttgctagacaggtgctttgacttgtgtatgttgtgtata |
46754709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University