View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784-Insertion-14 (Length: 235)
Name: NF0784-Insertion-14
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784-Insertion-14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 8 - 137
Target Start/End: Original strand, 42911491 - 42911620
Alignment:
| Q |
8 |
ccatgtgactattagattatagttaatggactctaggcacttgttaatgttgcaaactgaagcaaattggttttggtcaaaagttagcaacatcgaatta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42911491 |
ccatgtgactattagattatagttaatggactctaggcacttgttaatgttgcaaactgaagcaaattggttttggtcaaaagttagcaacatcgaatta |
42911590 |
T |
 |
| Q |
108 |
ctctcttcctcaaatattagtgttatatac |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42911591 |
ctctcttcctcaaatattagtgttatatac |
42911620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 138 - 235
Target Start/End: Original strand, 42912033 - 42912130
Alignment:
| Q |
138 |
ctccgaggatcttttttgttgtagccgctgttttgtgtttcgtttttctcgcgatttgttccaggaagatgatggtggtggtggtagtttgttccgga |
235 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
42912033 |
ctccgaggatcttttttgttatagccgctgttttgtgtttcgtttttctcgcgatttgttccaggaaggtggtggtggtggtggtagtttgttccgga |
42912130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University