View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784-Insertion-15 (Length: 213)
Name: NF0784-Insertion-15
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784-Insertion-15 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 8 - 213
Target Start/End: Original strand, 35772959 - 35773164
Alignment:
| Q |
8 |
catcattcttataatgcaacttcaaaaactcctcctctgccttctgatcatcctccaaataataacaagaagaattccctaagggtatgtatatgcaaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35772959 |
catcattcttataatgcaacttcaaaaactcctcctctgccttctgatcatcctccaaataataacaagaagaattccctaagggtatgtatatgcaaaa |
35773058 |
T |
|
| Q |
108 |
cacatatttgcatgtcatgtgcatttgttccataagtttaataaataattgaacattgacactaatcatatcttctctatgttccttttttgaatggtct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35773059 |
cacatatttgcatgtcatgtgcatttgttccataagtttaataaataattgaacattgacactaatcatatcttctctatgttccttttttgaatggtct |
35773158 |
T |
|
| Q |
208 |
gatctt |
213 |
Q |
| |
|
|||||| |
|
|
| T |
35773159 |
gatctt |
35773164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5193 times since January 2019
Visitors: 5755