View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784-Insertion-17 (Length: 155)
Name: NF0784-Insertion-17
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784-Insertion-17 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 8 - 155
Target Start/End: Original strand, 41863316 - 41863463
Alignment:
Q |
8 |
gcaatatctatgcaggttataggttggtcaatgtggtttgctgaatatttatttctagaaagaaactgggctaaagatgaatcatcattgaatgtaaata |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
41863316 |
gcaatatctatgcaggttataggttggtcaatgtggtttgctgaatatttatttctagaaagaaactgggctaaagatgaatcatcattgaaggtaaata |
41863415 |
T |
 |
Q |
108 |
aatccaaaaatattattttattaatttagatatatatgtgattattag |
155 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41863416 |
aatcaaaaaatattattttattaatttagatatatatgtgattattag |
41863463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 9e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 9e-19
Query Start/End: Original strand, 13 - 88
Target Start/End: Complemental strand, 42122079 - 42122004
Alignment:
Q |
13 |
atctatgcaggttataggttggtcaatgtggtttgctgaatatttatttctagaaagaaactgggctaaagatgaa |
88 |
Q |
|
|
|||| |||||||| ||||||||||||||||||||||||| | ||||||||| |||||||| |||||||| |||||| |
|
|
T |
42122079 |
atctgtgcaggttctaggttggtcaatgtggtttgctgattttttatttctggaaagaaattgggctaaggatgaa |
42122004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University