View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784-Insertion-18 (Length: 152)
Name: NF0784-Insertion-18
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784-Insertion-18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 1e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 7 - 151
Target Start/End: Complemental strand, 4610641 - 4610497
Alignment:
Q |
7 |
aaaaatgtcaagaattccatgattcttcatcttcttgttttgtctgaaaattggatgaaggtttttgcattctaacaccactgatactgtttctcgcaga |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4610641 |
aaaaatgtcaagaattccatgattcttcatcttcttgttttgtctgaaaattggatgaaggtttttgcattctaacaccactgatactgtttctcgcaga |
4610542 |
T |
 |
Q |
107 |
catcatttcattgagtgaaagccttttcttgacttcaggtctttg |
151 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4610541 |
catcatttcattgagtgaaagccttttcttgacttcaggtctttg |
4610497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University