View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784-Insertion-20 (Length: 112)
Name: NF0784-Insertion-20
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784-Insertion-20 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 4e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 7 - 112
Target Start/End: Complemental strand, 34815722 - 34815617
Alignment:
| Q |
7 |
atttaaggcattaatggcttatataaaagtatttggggtctgatcaacaaaactgaaaactatgaaaatccttgcagactgtttctgctttcctgtctta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34815722 |
atttaaggcattaatggcttatataaaagtatttggggtctgatcaacaaaactgaaaactatgaaaatccttgcagactgtttctgctttcctgtctta |
34815623 |
T |
 |
| Q |
107 |
ttgttt |
112 |
Q |
| |
|
| |||| |
|
|
| T |
34815622 |
tggttt |
34815617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.0000000000006
Query Start/End: Original strand, 34 - 103
Target Start/End: Complemental strand, 35865911 - 35865842
Alignment:
| Q |
34 |
agtatttggggtctgatcaacaaaactgaaaactatgaaaatccttgcagactgtttctgctttcctgtc |
103 |
Q |
| |
|
||||||||||| ||||||| |||||||| |||| ||||| |||||||| ||||||| |||||||||||| |
|
|
| T |
35865911 |
agtatttggggcctgatcattaaaactgagaactgtgaaagtccttgcaaactgtttatgctttcctgtc |
35865842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University