View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784-Insertion-21 (Length: 103)
Name: NF0784-Insertion-21
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784-Insertion-21 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 8e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 8e-43
Query Start/End: Original strand, 8 - 103
Target Start/End: Complemental strand, 52245989 - 52245894
Alignment:
| Q |
8 |
tttccccattacaatactgcatctccacaacctgtattatctgctacagcattactccaaaaagctgctcaagtgggttcaccttcatccaatgca |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52245989 |
tttccccattacaatactgcatctccacaacctgtattatctgctactgcattactccaaaaagctgctcaagtgggttcatcttcatccaatgca |
52245894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6021 times since January 2019
Visitors: 5762