View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784-Insertion-23 (Length: 91)
Name: NF0784-Insertion-23
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784-Insertion-23 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 4e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 4e-38
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 10219870 - 10219953
Alignment:
Q |
8 |
ctactgatgttcatcgcttttatattcggaattaccctgctgctacttataaatattacatggtatcattcattacttttcttg |
91 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
10219870 |
ctactgatgttcatcgcttttatattcggaattaccctgctgctacttataaatattacatggtatgattcattacttttcttg |
10219953 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University