View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784-Insertion-8 (Length: 335)
Name: NF0784-Insertion-8
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784-Insertion-8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 287
Target Start/End: Original strand, 40328640 - 40328916
Alignment:
Q |
8 |
aaatattacttctataattttttattatggtcattattatccaaaattaagtaacaaaccaaagatctttcaatctccagtnnnnnnnnnngaaacatgc |
107 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
40328640 |
aaatattactgctataattttttattatggtcattattatccaaaactaagtaacaaaccaaagatctttcaatctccagtaaaaaaa---gaaacatgc |
40328736 |
T |
 |
Q |
108 |
ttatcttctccaaagtcacgactaataaaaccaccacgtctccattgccacctacacggagagaatcactctactacatgacttgggtcctcgctcgtcg |
207 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40328737 |
ttatcttctccaaagtcacgactaataaaaccaccacgtctccattgccacctacacagagagaatcactctactacatgacttgggtcctcgctcgtcg |
40328836 |
T |
 |
Q |
208 |
tcactctagttggcttggcgggaatcactttaattgagaaccaaagagttgctttagatcatacccattttcactttctg |
287 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
40328837 |
tcactctagttggcttggcgggaatcactttaattgagaaccaaagagttgctttagatcatacctattttcactttctg |
40328916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4904 times since January 2019
Visitors: 5753