View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_high_100 (Length: 203)
Name: NF0784_high_100
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_high_100 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 49 - 191
Target Start/End: Original strand, 37159984 - 37160126
Alignment:
Q |
49 |
gctttaacaactttccaggcccaagtatgggacggttatgatgaatcacgtgatgtcataaagtgcgccattaaaatctaatacactccatccaccatgg |
148 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
37159984 |
gctttaacaactttccaggcccaagtatgggacggttatgatgaatcacgtgaggtcataaagtgcaccattaaaatctaatacactccatccaccatgg |
37160083 |
T |
 |
Q |
149 |
taataatcaatattcttgtagatagatttgtagttcctatgat |
191 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
37160084 |
taataatcaatattcttgtagatagatttgtagttcctttgat |
37160126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 49 - 191
Target Start/End: Original strand, 37204567 - 37204709
Alignment:
Q |
49 |
gctttaacaactttccaggcccaagtatgggacggttatgatgaatcacgtgatgtcataaagtgcgccattaaaatctaatacactccatccaccatgg |
148 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
37204567 |
gctttaacaactttccaggcccaagtatgggacggttatgatgaatcacgtgaggtcataaagtgcaccattaaaatctaatacactccatccaccatgg |
37204666 |
T |
 |
Q |
149 |
taataatcaatattcttgtagatagatttgtagttcctatgat |
191 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
37204667 |
taataatcaatattcttgtagatagatttgtagttcctttgat |
37204709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6306 times since January 2019
Visitors: 5767