View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0784_high_25 (Length: 430)

Name: NF0784_high_25
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0784_high_25
NF0784_high_25
[»] chr2 (5 HSPs)
chr2 (29-192)||(17608332-17608495)
chr2 (328-418)||(17608628-17608718)
chr2 (239-299)||(17608542-17608603)
chr2 (246-282)||(17667292-17667327)
chr2 (246-282)||(17704800-17704835)
[»] chr3 (1 HSPs)
chr3 (123-192)||(48256410-48256479)


Alignment Details
Target: chr2 (Bit Score: 160; Significance: 4e-85; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 29 - 192
Target Start/End: Original strand, 17608332 - 17608495
Alignment:
29 agaagaagtggtggaacatgatgagattagtcccattggtgatggtgaagatgatgaagatgttgtttccaccttaaccatggaaagggttgctgctgct 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17608332 agaagaagtggtggaacatgatgagattagtcccattggtgatggtgaagatgatgaagatgttgtttccaccttaaccatggaaagggttgctgctgct 17608431  T
129 aagaaattcattgagagtcattataagtctcagatgaaacacattcaagaacgcaaagaaaggt 192  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
17608432 aagaaattcattgagagtcattataagtctcaaatgaaacacattcaagaacgcaaagaaaggt 17608495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 328 - 418
Target Start/End: Original strand, 17608628 - 17608718
Alignment:
328 ataatcatgttattggtgcgaagtatcacctggttttgccacctctccaaaccgtgnnnnnnncacccacattgattgaacccgaaatatt 418  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||    
17608628 ataatcatgttattggtgcgaagtatcacctggttttgccacctctccaaaccgtgtttttttcacccacattgattgaacccgaaatatt 17608718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 239 - 299
Target Start/End: Original strand, 17608542 - 17608603
Alignment:
239 gtcttggttaagatctgtttgtttcactttgcatgttg-ttgatgacctccttttgtgaaat 299  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
17608542 gtcttggttaagatctgtttgtttcactttgcatgttgtttgatgacctccttttgtgaaat 17608603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 246 - 282
Target Start/End: Original strand, 17667292 - 17667327
Alignment:
246 ttaagatctgtttgtttcactttgcatgttgttgatg 282  Q
    |||||||||||||||| ||||||||||||||||||||    
17667292 ttaagatctgtttgtt-cactttgcatgttgttgatg 17667327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 246 - 282
Target Start/End: Original strand, 17704800 - 17704835
Alignment:
246 ttaagatctgtttgtttcactttgcatgttgttgatg 282  Q
    ||||||||||||||||| |||||||||||||||||||    
17704800 ttaagatctgtttgttt-actttgcatgttgttgatg 17704835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 192
Target Start/End: Original strand, 48256410 - 48256479
Alignment:
123 gctgctaagaaattcattgagagtcattataagtctcagatgaaacacattcaagaacgcaaagaaaggt 192  Q
    |||||||||||||||||||||| |||||| | | | ||||||||| | |||||||| || ||||| ||||    
48256410 gctgctaagaaattcattgagaatcattacagggcacagatgaaaaatattcaagatcggaaagagaggt 48256479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5802 times since January 2019
Visitors: 5759