View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_high_26 (Length: 426)
Name: NF0784_high_26
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 1e-72; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 190 - 360
Target Start/End: Original strand, 4610796 - 4610966
Alignment:
| Q |
190 |
gtaaccaagtggtttacatctagtaaagaatttggtttggtttcttttaaagaatacaactctgtactcatagcaattgttatcagtaccttacgataca |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4610796 |
gtaaccaagtggtttacatctagtaaagaatttggtttggtttcttttaaagaatacaactctgtactcatagcaattgttatcagtaccttacgataca |
4610895 |
T |
 |
| Q |
290 |
cgccattcatatctcatttcaatgcagaactagatcgaatcaatacgaatttctaatgtgtatcgcgagcc |
360 |
Q |
| |
|
|| | || ||||||||||||||||| |||| |||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
4610896 |
tgcgactcgtatctcatttcaatgcaaaactggatcaaatcaatacgaatttctagtgtgtatcgcgagcc |
4610966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 30 - 104
Target Start/End: Original strand, 4610636 - 4610710
Alignment:
| Q |
30 |
atttttagttgtcacagtattggagaaatttgagaggaaactaaagatgtaatgatgttagttagtgctttggaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4610636 |
atttttagttgtcacagtattggagaaatttgagaggaaactaaagatgtaatgatgttagttagtgctttggaa |
4610710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 364 - 416
Target Start/End: Original strand, 4610997 - 4611049
Alignment:
| Q |
364 |
atggtaaatcatgattcattctaatggtttcctttgtcaagttatttcctatg |
416 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4610997 |
atggtaaatcatgatttattttaatggtttcctttgtcaagttatttcctatg |
4611049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University