View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_high_28 (Length: 399)
Name: NF0784_high_28
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 95 - 394
Target Start/End: Original strand, 10330509 - 10330807
Alignment:
Q |
95 |
ttattgtgtaacatttcattgcaggataatatagagcacacttgaatatgagataataatctcgattgaatgtattcggttgaagaatcttactgagtta |
194 |
Q |
|
|
||||||| ||| |||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
T |
10330509 |
ttattgtctaatatttcattgcaggataatgtagagcacacttgaatatgagattataatctcgattgaatgtattcagttgaagaatcttaca-agtta |
10330607 |
T |
 |
Q |
195 |
atatctattttgaagaaatagcatatcccctttgtataaggtcacttaaaaacatttgattcctttaaaaatttcgttgtttggtaagagatttatgtca |
294 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10330608 |
atatctattttgaagaaatagcatattccctttgtataaggtcacttgaaaacatttgattcctttaaaaatttcgttgtttggtaagagatttatgtca |
10330707 |
T |
 |
Q |
295 |
caaaattccatcggcaccaaattcaaatcttttgttagactatatcacaaaatttggaaaattataccatgtccaccgtccctgcttaccctatgatact |
394 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
10330708 |
caaaattccatcggcaccaaattcaaatcttttgttagactatatcacaaaatttggaaaattataccatgtccaccgtccctgcttaccttatgatact |
10330807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6872 times since January 2019
Visitors: 5772