View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_high_52 (Length: 301)
Name: NF0784_high_52
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_high_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 65 - 97
Target Start/End: Original strand, 17353040 - 17353072
Alignment:
Q |
65 |
atgaaaagctgccagctgtatatttttgtattt |
97 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
17353040 |
atgaaaagctgccagctgtatatttttgtattt |
17353072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 229
Target Start/End: Original strand, 17353169 - 17353205
Alignment:
Q |
193 |
tgaagttagtgaacacacactagcagctccctctctc |
229 |
Q |
|
|
||||| ||||||||||||||||||||||| ||||||| |
|
|
T |
17353169 |
tgaaggtagtgaacacacactagcagctctctctctc |
17353205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 65 - 97
Target Start/End: Original strand, 20583168 - 20583200
Alignment:
Q |
65 |
atgaaaagctgccagctgtatatttttgtattt |
97 |
Q |
|
|
||||||||||||||||||||||| ||||||||| |
|
|
T |
20583168 |
atgaaaagctgccagctgtatatctttgtattt |
20583200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University