View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_high_58 (Length: 279)
Name: NF0784_high_58
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_high_58 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 27 - 140
Target Start/End: Original strand, 47516915 - 47517028
Alignment:
| Q |
27 |
ggcagaaaatatagcagattcatgggtttcggctctggatccaccgtgcagttttacggtaaaatcatattactcattgctgtccaaggttagtttttca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47516915 |
ggcagaaaatatagcagattcatgggtttcggctctggatccaccgtgcagttttacggtaaaatcatattactcattgctgtctaaggttagtttttca |
47517014 |
T |
|
| Q |
127 |
gcagaaaatatgga |
140 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47517015 |
gcagaaaatatgga |
47517028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 142 - 233
Target Start/End: Original strand, 47517102 - 47517193
Alignment:
| Q |
142 |
gatagattggcgacaagagataatttgttcaaaaggggcatcttaacctcaccacatcaaaggttttgtgtgtactgcttcgcagaaccaga |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47517102 |
gatagattggcgacaagagataatttgttcaaaaggggcatcttaacctcaccacatcaaaggttttgtgtgtgctgcttcgcagaaccaga |
47517193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6568 times since January 2019
Visitors: 5769