View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0784_high_58 (Length: 279)

Name: NF0784_high_58
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0784_high_58
NF0784_high_58
[»] chr1 (2 HSPs)
chr1 (27-140)||(47516915-47517028)
chr1 (142-233)||(47517102-47517193)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 27 - 140
Target Start/End: Original strand, 47516915 - 47517028
Alignment:
27 ggcagaaaatatagcagattcatgggtttcggctctggatccaccgtgcagttttacggtaaaatcatattactcattgctgtccaaggttagtttttca 126  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
47516915 ggcagaaaatatagcagattcatgggtttcggctctggatccaccgtgcagttttacggtaaaatcatattactcattgctgtctaaggttagtttttca 47517014  T
127 gcagaaaatatgga 140  Q
    ||||||||||||||    
47517015 gcagaaaatatgga 47517028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 142 - 233
Target Start/End: Original strand, 47517102 - 47517193
Alignment:
142 gatagattggcgacaagagataatttgttcaaaaggggcatcttaacctcaccacatcaaaggttttgtgtgtactgcttcgcagaaccaga 233  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
47517102 gatagattggcgacaagagataatttgttcaaaaggggcatcttaacctcaccacatcaaaggttttgtgtgtgctgcttcgcagaaccaga 47517193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6568 times since January 2019
Visitors: 5769