View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_high_60 (Length: 274)
Name: NF0784_high_60
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_high_60 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 47 - 274
Target Start/End: Complemental strand, 5964972 - 5964740
Alignment:
| Q |
47 |
gaacatagaaccgtctataaaactacttaagagaatgataagtatcttagaattcttgaaataaaatattg----gggggagccctcctcctggaagaga |
142 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
5964972 |
gaacagagaaccgtctataaaactacttaagagaatgataagtatcttagaattcttgaaataaaatattgtggggggggggccctcctcctggaagaga |
5964873 |
T |
 |
| Q |
143 |
aaaagggctctgatagggttttgccttagggtttgctctctgccttctatgctgctaccatatgtcaatggccatcccaatgtcgt-gaaaacttcttct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||| |
|
|
| T |
5964872 |
aaaagggctctgatagggttttgccttagggtttgctctctgccttctatgctgctaccatatgtcaatggccatctcaatgtcgtagaaaacttcgtct |
5964773 |
T |
 |
| Q |
242 |
aagtggcgttaaaggtatttaatcaatgttgcg |
274 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |
|
|
| T |
5964772 |
gaggggcgttaaaggtatttaatcaatgttgcg |
5964740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University