View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0784_high_61 (Length: 274)

Name: NF0784_high_61
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0784_high_61
NF0784_high_61
[»] chr6 (1 HSPs)
chr6 (47-274)||(5964740-5964972)


Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 47 - 274
Target Start/End: Complemental strand, 5964972 - 5964740
Alignment:
47 gaacatagaaccgtctataaaactacttaagagaatgataagtatcttagaattcttgaaataaaatattg----gggggagccctcctcctggaagaga 142  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||| |||||||||||||||||||    
5964972 gaacagagaaccgtctataaaactacttaagagaatgataagtatcttagaattcttgaaataaaatattgtggggggggggccctcctcctggaagaga 5964873  T
143 aaaagggctctgatagggttttgccttagggtttgctctctgccttctatgctgctaccatatgtcaatggccatctcaatgtcgt-gaaaacttcttct 241  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||    
5964872 aaaagggctctgatagggttttgccttagggtttgctctctgccttctatgctgctaccatatgtcaatggccatctcaatgtcgtagaaaacttcgtct 5964773  T
242 aagtggcgttaaaggtatttaatcaatgttgcg 274  Q
     || |||||||||||||||||||||||||||||    
5964772 gaggggcgttaaaggtatttaatcaatgttgcg 5964740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5986 times since January 2019
Visitors: 5761