View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_high_65 (Length: 271)
Name: NF0784_high_65
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_high_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 28 - 261
Target Start/End: Complemental strand, 48676070 - 48675837
Alignment:
| Q |
28 |
caagtggagccttaagtcaagcaatgcaagaatacacgtggatccagttacaatattaatctcttgccatgtaggattttatcttcaatcttcaattcaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48676070 |
caagtggagccttaagtcaagcaatgcaagaatacacgtggatccacttacaatattaatctcttgccatgtaggattttatcttcaatcttcaattcaa |
48675971 |
T |
 |
| Q |
128 |
tataaattgtggccaaagtgaagctactaaatatccaagtgcaacaattagcttagctagagacttaaaatgggagggagaatgtctaagttgaggagaa |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48675970 |
tataaattgtggccaaagtgaagctactaaatatccaagtgcaacaattagcttagctagagacttaaaatgggagggagaatgtctaagttgaggagaa |
48675871 |
T |
 |
| Q |
228 |
ttgtaaggcaacaaaaggggaaactttatattat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
48675870 |
ttgtaaggcaacaaaaggggaaactttatattat |
48675837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University