View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_high_66 (Length: 269)
Name: NF0784_high_66
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_high_66 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 238
Target Start/End: Original strand, 15814463 - 15814686
Alignment:
| Q |
14 |
agaggttgatagatgtttggaaagtctaccaaattgggtcaataaatgataattattttttgaaggaaataaatgataaaatttgtctccatagagattg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15814463 |
agaggttgatagatgtttggaaagtctaccaaattgggtcaataaatgataatt-ttttttgaaggtaataaatgataaaatttgtctccatagagattg |
15814561 |
T |
|
| Q |
114 |
tgatcaatcaacaaactcatcaataagaacggaagtatccttaacagcaataagaacggaagtatcatggataactctatagttgcaaagattcgccgtc |
213 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15814562 |
tgatcaatcaataaacccatcaataagaacggaagtatccttaacagcaataagaacggaagtatcatggataactctatagttgcaaagattcgacgtc |
15814661 |
T |
|
| Q |
214 |
ttcttcagatggattgtgaggtggt |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
15814662 |
ttcttcagatggattgtgaggtggt |
15814686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 92 - 137
Target Start/End: Original strand, 16072354 - 16072399
Alignment:
| Q |
92 |
aaatttgtctccatagagattgtgatcaatcaacaaactcatcaat |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||| |||||||| |
|
|
| T |
16072354 |
aaatttgtctccatagagattgtgatcaatcgataaaatcatcaat |
16072399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 92 - 137
Target Start/End: Original strand, 16086007 - 16086052
Alignment:
| Q |
92 |
aaatttgtctccatagagattgtgatcaatcaacaaactcatcaat |
137 |
Q |
| |
|
||||||||||| |||||||||||||||||| | |||||||||||| |
|
|
| T |
16086007 |
aaatttgtctctatagagattgtgatcaattgataaactcatcaat |
16086052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 156 - 229
Target Start/End: Original strand, 20378360 - 20378433
Alignment:
| Q |
156 |
aacagcaataagaacggaagtatcatggataactctatagttgcaaagattcgccgtcttcttcagatggattg |
229 |
Q |
| |
|
||||| |||||||| |||||||| ||| || ||| |||||||||||||||| ||| | |||||||||||||| |
|
|
| T |
20378360 |
aacagtaataagaatggaagtattatgagtatatctttagttgcaaagattcgtcgtttccttcagatggattg |
20378433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7184 times since January 2019
Visitors: 5775