View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_high_69 (Length: 267)
Name: NF0784_high_69
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_high_69 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 47 - 237
Target Start/End: Complemental strand, 5964972 - 5964777
Alignment:
| Q |
47 |
gaacatagaaccgtctataaaactacttaagagaatgataagtatcttagaattcttgaaataaaatattg----gggggagccctcctcctggaagaga |
142 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
5964972 |
gaacagagaaccgtctataaaactacttaagagaatgataagtatcttagaattcttgaaataaaatattgtggggggggggccctcctcctggaagaga |
5964873 |
T |
|
| Q |
143 |
aaaagggctctgatagggttttgccttagggtttgctctctgccttctatgctgctaccatatgtcaatggccatctcaatgtcgt-gaaaacttc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5964872 |
aaaagggctctgatagggttttgccttagggtttgctctctgccttctatgctgctaccatatgtcaatggccatctcaatgtcgtagaaaacttc |
5964777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7068 times since January 2019
Visitors: 5773