View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_high_70 (Length: 265)
Name: NF0784_high_70
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_high_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 43440296 - 43440567
Alignment:
Q |
1 |
attgtgaagctgggttttatagctttaacgttgcgttgatttgctgccgtgcttttctcaattctaccatgctac-caaacaggccattagtctattt-- |
97 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
43440296 |
attgtgaaactgggttttatagctttaacgttgcggtgatttgctgccgtgcttttctcaattctaccatgctaggcaaacaggccattagtctatttat |
43440395 |
T |
 |
Q |
98 |
----------ctttgttaattaaaagaattgcatatatcaataatctcacactgttttttacaagacacggtgcatatatagctttattnnnnnnnttat |
187 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
T |
43440396 |
ataaaatcttctttgttaattaaaagaattgcatatatcaatcatctcacactgttttttacaagacacggtgcatatatagttttattaaaaaaattat |
43440495 |
T |
 |
Q |
188 |
ggtagccttctagtttctaagaaaagatgacaatgttcattaggaattaaacctcaagataagtataatcta |
259 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43440496 |
ggtagccttctagtttctaagaaaagatgactatgttcattaggaattaaacctcaagataagtataatcta |
43440567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 37 - 89
Target Start/End: Complemental strand, 11051753 - 11051701
Alignment:
Q |
37 |
tgatttgctgccgtgcttttctcaattctaccatgctaccaaacaggccatta |
89 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
T |
11051753 |
tgatttgctgccgtgcttttctcaattctaccgagctaccaaacagaccatta |
11051701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 34123033 - 34123122
Alignment:
Q |
1 |
attgtgaagctgggttttatagctttaacgttgcgttgatttgctgccgtgcttttctcaattctaccatgctaccaaacaggccattag |
90 |
Q |
|
|
|||||||||||||||||| ||||||| |||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
34123033 |
attgtgaagctgggttttgaagctttagcgttgccgtgatttgctgctgtgcttttctcaattctaccgtgctaccaaacaggccattag |
34123122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 48957671 - 48957585
Alignment:
Q |
1 |
attgtgaagctgggttttatagctttaacgttgcgttgatttgctgccgtgcttttctcaattctaccatgctaccaaacaggccat |
87 |
Q |
|
|
||||||||| |||||||| ||||||| |||||| |||||| || |||| ||||||||||||||||| |||||||||||| ||||| |
|
|
T |
48957671 |
attgtgaagttgggttttgaagctttagcgttgccgtgatttccttccgtccttttctcaattctaccgtgctaccaaacatgccat |
48957585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University