View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_high_86 (Length: 251)
Name: NF0784_high_86
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_high_86 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 1461649 - 1461407
Alignment:
Q |
1 |
ccgcatgagcccttttactcacattccctttgcagttacaaagcttcaatatctgaaataacataacatcatgtgttagttagtcatcttattaaacata |
100 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
1461649 |
ccgcatgagcccttttactcacattctctttgcagttacaaagctccaatatctgaaataacataacatcatgtcttagttagtcatcttattaaacata |
1461550 |
T |
 |
Q |
101 |
acaaagataacaccagggtctagcgtgagtggttgatgctcatagtgtgtgagtgttgtaaaccttggaattcaattcctattgataaagaaaacacata |
200 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1461549 |
acaaagataacaccagggtctagcgtaagtggttgatgctcatagtgtgtgagtgttgtaaaccttggaattcaattcctattgataaagaaaacacata |
1461450 |
T |
 |
Q |
201 |
acaagttgaaactcatatctacctgttcaggagcccctttgct |
243 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1461449 |
acaagttgaaactcatatctacctgttcaggagcccctttgct |
1461407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 195 - 243
Target Start/End: Complemental strand, 26789036 - 26788988
Alignment:
Q |
195 |
cacataacaagttgaaactcatatctacctgttcaggagcccctttgct |
243 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
26789036 |
cacataacaagttgaaactcatatttacctgttcaggagcccctttgct |
26788988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 58
Target Start/End: Complemental strand, 26789139 - 26789084
Alignment:
Q |
3 |
gcatgagcccttttactcacattccctttgcagttacaaagcttcaatatctgaaa |
58 |
Q |
|
|
|||||| ||||||| ||||||||| |||||||||||||||| | |||||||||||| |
|
|
T |
26789139 |
gcatgaacccttttcctcacattctctttgcagttacaaagttccaatatctgaaa |
26789084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6742 times since January 2019
Visitors: 5771