View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0784_high_87 (Length: 237)

Name: NF0784_high_87
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0784_high_87
NF0784_high_87
[»] chr7 (1 HSPs)
chr7 (1-136)||(36733619-36733753)


Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 36733753 - 36733619
Alignment:
1 ggtgtattataggtccatattttgttgaaagtttatgaagtccttggtgaggtattgaaccaataaggtgatgatgtccatctcattggtaaagataatg 100  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||  | ||||||||||||||||    
36733753 ggtgtattataggtccatattttgttgaaagtttgtgaagtccttggtgaggtattgaaccaataaggtgaagatgtcca-atgattggtaaagataatg 36733655  T
101 gacttggaggtaacttcgatttcttgtatattcttg 136  Q
    ||||||||||||||||||||||||||||| ||||||    
36733654 gacttggaggtaacttcgatttcttgtattttcttg 36733619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 11 times since January 2019
Visitors: 5776