View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_high_90 (Length: 233)
Name: NF0784_high_90
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_high_90 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 20 - 233
Target Start/End: Original strand, 15814463 - 15814675
Alignment:
| Q |
20 |
agaggttgatagatgtttggaaagtctaccaaattgggtcaataaatgataattattttttgaaggaaataaatgataaaatttgtctccatagagattg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15814463 |
agaggttgatagatgtttggaaagtctaccaaattgggtcaataaatgataatt-ttttttgaaggtaataaatgataaaatttgtctccatagagattg |
15814561 |
T |
 |
| Q |
120 |
tgatcaatcaacaaactcatcaataagaacggaagtatcattaacatcaataagaacgtaagtatcatggctaactctctcgttgcaaagattcgccgta |
219 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||| |||||| ||||||||||| ||||||||||| ||||||| | |||||||||||||| ||| |
|
|
| T |
15814562 |
tgatcaatcaataaacccatcaataagaacggaagtatccttaacagcaataagaacggaagtatcatggataactctatagttgcaaagattcgacgtc |
15814661 |
T |
 |
| Q |
220 |
ttcttctgatggat |
233 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
15814662 |
ttcttcagatggat |
15814675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 98 - 143
Target Start/End: Original strand, 16072354 - 16072399
Alignment:
| Q |
98 |
aaatttgtctccatagagattgtgatcaatcaacaaactcatcaat |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||| |||||||| |
|
|
| T |
16072354 |
aaatttgtctccatagagattgtgatcaatcgataaaatcatcaat |
16072399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 98 - 143
Target Start/End: Original strand, 16086007 - 16086052
Alignment:
| Q |
98 |
aaatttgtctccatagagattgtgatcaatcaacaaactcatcaat |
143 |
Q |
| |
|
||||||||||| |||||||||||||||||| | |||||||||||| |
|
|
| T |
16086007 |
aaatttgtctctatagagattgtgatcaattgataaactcatcaat |
16086052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University