View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_high_97 (Length: 215)
Name: NF0784_high_97
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_high_97 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 113 - 215
Target Start/End: Complemental strand, 43439852 - 43439750
Alignment:
| Q |
113 |
aggacacagtacaaagttaaacttataattggtaatccaaaagaaagaaagaaaattatgaactctaaacaaattatggagttaggtcactcttcaagtg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43439852 |
aggacacagtacaaagttaaacttataattggtaatccaaaagaaagaaagaaaattatgaactctaaacaaattatggagctaggtcactcttcaagtg |
43439753 |
T |
 |
| Q |
213 |
aat |
215 |
Q |
| |
|
||| |
|
|
| T |
43439752 |
aat |
43439750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University