View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0784_low_108 (Length: 269)

Name: NF0784_low_108
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0784_low_108
NF0784_low_108
[»] chr1 (3 HSPs)
chr1 (14-238)||(15814463-15814686)
chr1 (92-137)||(16072354-16072399)
chr1 (92-137)||(16086007-16086052)
[»] chr4 (1 HSPs)
chr4 (156-229)||(20378360-20378433)


Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 238
Target Start/End: Original strand, 15814463 - 15814686
Alignment:
14 agaggttgatagatgtttggaaagtctaccaaattgggtcaataaatgataattattttttgaaggaaataaatgataaaatttgtctccatagagattg 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||    
15814463 agaggttgatagatgtttggaaagtctaccaaattgggtcaataaatgataatt-ttttttgaaggtaataaatgataaaatttgtctccatagagattg 15814561  T
114 tgatcaatcaacaaactcatcaataagaacggaagtatccttaacagcaataagaacggaagtatcatggataactctatagttgcaaagattcgccgtc 213  Q
    ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
15814562 tgatcaatcaataaacccatcaataagaacggaagtatccttaacagcaataagaacggaagtatcatggataactctatagttgcaaagattcgacgtc 15814661  T
214 ttcttcagatggattgtgaggtggt 238  Q
    |||||||||||||||||||||||||    
15814662 ttcttcagatggattgtgaggtggt 15814686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 92 - 137
Target Start/End: Original strand, 16072354 - 16072399
Alignment:
92 aaatttgtctccatagagattgtgatcaatcaacaaactcatcaat 137  Q
    ||||||||||||||||||||||||||||||| | ||| ||||||||    
16072354 aaatttgtctccatagagattgtgatcaatcgataaaatcatcaat 16072399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 92 - 137
Target Start/End: Original strand, 16086007 - 16086052
Alignment:
92 aaatttgtctccatagagattgtgatcaatcaacaaactcatcaat 137  Q
    ||||||||||| ||||||||||||||||||  | ||||||||||||    
16086007 aaatttgtctctatagagattgtgatcaattgataaactcatcaat 16086052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 156 - 229
Target Start/End: Original strand, 20378360 - 20378433
Alignment:
156 aacagcaataagaacggaagtatcatggataactctatagttgcaaagattcgccgtcttcttcagatggattg 229  Q
    ||||| |||||||| |||||||| |||  ||  ||| |||||||||||||||| ||| | ||||||||||||||    
20378360 aacagtaataagaatggaagtattatgagtatatctttagttgcaaagattcgtcgtttccttcagatggattg 20378433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5940 times since January 2019
Visitors: 5761