View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_115 (Length: 264)
Name: NF0784_low_115
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_115 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 28610193 - 28610268
Alignment:
| Q |
1 |
cgaaacaaaattcctttcttaacctccacgcttcagtgttctggattcttctttcatctccttataaatcaacaac |
76 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28610193 |
cgaaacaaaattcctttcttaatctccacgcttcagtgttctggattcttctttcatctccttataaatcaacaac |
28610268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University