View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_116 (Length: 260)
Name: NF0784_low_116
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_116 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 36867403 - 36867633
Alignment:
| Q |
1 |
ctgcagttgttccaacttccaacagattggtataacatattccagttcgattaatccattaatctaaaagatcaagggaaagttcaaacgcaacctcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36867403 |
ctgcagttgttccaacttccaacagattggtataacatattccagttcgattaatccattaatctaaaagatcaagggaaagttcaaacgcaacctcaaa |
36867502 |
T |
|
| Q |
101 |
taaactctttgcatatgctcgtgttcaaaggagacaattatgattagtggcatgcctaaatgaaagtgaatgatggtcgcaaactacggtgcaaaaacct |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
36867503 |
taaattctttgcatatgctcgtgttcaaaggagacaattatgattagtggtgtgcctaaatgaaagtgaatgatggttgcaaactacggcgcaaaaacct |
36867602 |
T |
|
| Q |
201 |
gtgcatcgtgagttcaagaaaagatgcatat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36867603 |
gtgcatcgtgagttcaagaaaagatgcatat |
36867633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6877 times since January 2019
Visitors: 5772