View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_117 (Length: 258)
Name: NF0784_low_117
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_low_117 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 23 - 258
Target Start/End: Original strand, 38420900 - 38421130
Alignment:
Q |
23 |
catcactgtcacaacaatggaaccccagttaaacattcttattattaattcaaacaattctatgatcaccttcaatgcaatgcaatggaatgcaaatttt |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38420900 |
catcactgtcacaacaatggaaccccagttaaacattcttattattaattcaaacaattctatgatcaccttcaatgcaatgcaatggaatgcaaatttt |
38420999 |
T |
 |
Q |
123 |
agtatgcatttgattaatttatatagtggtatgtatgtactaataattaatttaataagtgggtatnnnnnnnaggcttggatgattaagctactgtgga |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
38421000 |
agtatgcatttgattaatttatatagtggtatgtatgtactaataattaatttaataagtgggtat-ggggggaggcttggatgattaagctactgtgga |
38421098 |
T |
 |
Q |
223 |
ttcacttccaattaatgtgcatgtgatgcttgtcac |
258 |
Q |
|
|
|||||| || ||||||||||||||||||||||| |
|
|
T |
38421099 |
ttcactccc----aatgtgcatgtgatgcttgtcac |
38421130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University