View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_118 (Length: 257)
Name: NF0784_low_118
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_low_118 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 48 - 228
Target Start/End: Original strand, 8264713 - 8264894
Alignment:
Q |
48 |
cctgagttgggacaggagttttagctctgctctttgcttacatacgctcagtaggccactggtagctattaacaactatagattctacaagatcataaca |
147 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8264713 |
cctgagttgggacaggagttgtagctctgctctttgcttacatacgctcagtaggccactggtagctattaacaactatagattctacaagatcataaca |
8264812 |
T |
 |
Q |
148 |
ctctttataggactttctcaatagtgcacct-ctgaagaggtatctaccataagccttgttgatggaacaaacccattgtaa |
228 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
T |
8264813 |
ctctttataggactttctcaatagtgcacctcctgaagaggcatctaccataagatttgttgatggaacaaacccattgtaa |
8264894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6861 times since January 2019
Visitors: 5772