View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_121 (Length: 253)
Name: NF0784_low_121
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_121 |
 | |
|
| [»] scaffold0014 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0014 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 14 - 249
Target Start/End: Original strand, 89200 - 89435
Alignment:
| Q |
14 |
agattcggcaaggtctatagacagaaaatcacaataaacgaagacaactcatcaacaaagtggtgatcagttagaaaaccagcttttagaagacctaaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
89200 |
agattcggcaaggtctatagacagaaaatcacaataaacgaagacaactcatcaacaaagtggtgatcagttagaaaaccagcttttagaaggcctaaat |
89299 |
T |
|
| Q |
114 |
gtttgaaacaccgacacattgataacaaacaagagcttctcaacaatgtttatatatttcaaagagcttctctcaattgtttgatcccttggaggttttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
89300 |
gtttgaaacaccgacacattgataacaaacaagagcttctcaacaatgtttatatatttcaaagagcttctctcaattgtttgatcacttggaggttatt |
89399 |
T |
|
| Q |
214 |
gtgaactacaaccataactctcaagtgaatattttt |
249 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
89400 |
gtgaactacaaccataactgtcaagtgattattttt |
89435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6166 times since January 2019
Visitors: 5762