View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_126 (Length: 251)
Name: NF0784_low_126
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_low_126 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 29 - 251
Target Start/End: Original strand, 44272384 - 44272606
Alignment:
Q |
29 |
gctttaagccatgtgatgggtttaagaacctggttttggggtttgtgggaagagagagaaacccttttgagtgaagaacagcttccatgtttctatgatg |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44272384 |
gctttaagccatgtgatgggtttaagaacctggttttggggtttgtgggaagagagagaaacccttttgagtgaagaacagcttccatgtttctatgatg |
44272483 |
T |
 |
Q |
129 |
aattcaacaaaacatgagcaatgagggatagaaaagatgggtggagattgaagatttgagttgatagattatatattctattctgaaaatgatgaaaagt |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44272484 |
aattcaacaaaacatgagcaatgagggatagaaaagatgggtggagattgaagatttgagttgatagattatatattctattctgaaaatgatgaaaagt |
44272583 |
T |
 |
Q |
229 |
ggggagatacaaatatctttgct |
251 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
44272584 |
ggggagatacaaatatctttgct |
44272606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6977 times since January 2019
Visitors: 5773