View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_129 (Length: 251)
Name: NF0784_low_129
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_129 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 35351359 - 35351599
Alignment:
| Q |
11 |
caaagggtgaggaggtataaaagtgatgagagagaaaggtagtgtgagaaaatcagatttgtaaattcaattatttgcttaaattgaatatcagaagtga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35351359 |
caaagggtgaggaggtataaaagtgatgagagagaaaggtagtgtgagaaaatcagatttgtaaattcaattatttgcttaaattgaatatcagaagtga |
35351458 |
T |
|
| Q |
111 |
tgtttaaggaaaaactttttatttttatataggatgtgactatttcagcaaaaccaaatagcaacatattattcttagtggcatagttatcattgtacat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35351459 |
tgtttaaggaaaaactttttatttttatataggatgtgactatttcagcaaaaccaaatagcaacatattattcttagtggcatagttatcattgtgcat |
35351558 |
T |
|
| Q |
211 |
gtgcatattattttacatgcatctcatcacattcacacatc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35351559 |
gtgcatattattttacatgcatctcatcacattcacacatc |
35351599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6364 times since January 2019
Visitors: 5767