View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_130 (Length: 251)
Name: NF0784_low_130
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_130 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 35351362 - 35351599
Alignment:
| Q |
14 |
agggtgaggaggtataaaagtgatgagagagaaaggtagtgtgagaaaatcagatttgtaaattcaattatttgcttaaattgaatatcagaagtgatgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35351362 |
agggtgaggaggtataaaagtgatgagagagaaaggtagtgtgagaaaatcagatttgtaaattcaattatttgcttaaattgaatatcagaagtgatgt |
35351461 |
T |
|
| Q |
114 |
ttaaggaaaaactttttatttttatataggatgtgactatttcagcaaaaccaaatagcaacatattattcttagtggcatagttatcattgtacatgtg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35351462 |
ttaaggaaaaactttttatttttatataggatgtgactatttcagcaaaaccaaatagcaacatattattcttagtggcatagttatcattgtgcatgtg |
35351561 |
T |
|
| Q |
214 |
catattattttacatgcatctcatcacattcacacatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35351562 |
catattattttacatgcatctcatcacattcacacatc |
35351599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6781 times since January 2019
Visitors: 5771