View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_134 (Length: 237)
Name: NF0784_low_134
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_low_134 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 36733753 - 36733619
Alignment:
Q |
1 |
ggtgtattataggtccatattttgttgaaagtttatgaagtccttggtgaggtattgaaccaataaggtgatgatgtccatctcattggtaaagataatg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| | |||||||||||||||| |
|
|
T |
36733753 |
ggtgtattataggtccatattttgttgaaagtttgtgaagtccttggtgaggtattgaaccaataaggtgaagatgtcca-atgattggtaaagataatg |
36733655 |
T |
 |
Q |
101 |
gacttggaggtaacttcgatttcttgtatattcttg |
136 |
Q |
|
|
||||||||||||||||||||||||||||| |||||| |
|
|
T |
36733654 |
gacttggaggtaacttcgatttcttgtattttcttg |
36733619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5999 times since January 2019
Visitors: 5761