View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0784_low_143 (Length: 236)

Name: NF0784_low_143
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0784_low_143
NF0784_low_143
[»] chr7 (1 HSPs)
chr7 (134-206)||(41706855-41706927)
[»] chr6 (1 HSPs)
chr6 (134-206)||(26217450-26217522)
[»] chr4 (1 HSPs)
chr4 (1-55)||(44185402-44185456)


Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 134 - 206
Target Start/End: Complemental strand, 41706927 - 41706855
Alignment:
134 agatgaagttaaataagtgatatacttgcggtggagcaatgcatggttaaggcaggatatgatgaggcaatat 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41706927 agatgaagttaaataagtgatatacttgcggtggagcaatgcatggttaaggcaggatatgatgaggcaatat 41706855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 134 - 206
Target Start/End: Complemental strand, 26217522 - 26217450
Alignment:
134 agatgaagttaaataagtgatatacttgcggtggagcaatgcatggttaaggcaggatatgatgaggcaatat 206  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26217522 agatgaagttaagtaagtgatatacttgcggtggagcaatgcatggttaaggcaggatatgatgaggcaatat 26217450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 44185402 - 44185456
Alignment:
1 aaccgtagctatactcttgatgaaatttcgttttctattcttgtcaaatttcccc 55  Q
    ||||||||||||| || |||||||||||||||||||||||||  |||||| ||||    
44185402 aaccgtagctatattcctgatgaaatttcgttttctattctttccaaattacccc 44185456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5288 times since January 2019
Visitors: 5755