View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_146 (Length: 229)
Name: NF0784_low_146
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_146 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 13 - 229
Target Start/End: Original strand, 15814460 - 15814675
Alignment:
| Q |
13 |
cagagaggttgatagatgtttggaaagtctaccaaattgggtcaataaatgataattattttttgaaggaaataaatgataaaatttgtctccatagaga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15814460 |
cagagaggttgatagatgtttggaaagtctaccaaattgggtcaataaatgataatt-ttttttgaaggtaataaatgataaaatttgtctccatagaga |
15814558 |
T |
 |
| Q |
113 |
ttgtgatcaatcaacaaactcatcaataagaacggaagtatcattaacatcaataagaacgtaagtatcatggctaactctctcgttgcaaagattcgcc |
212 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||| |||||| ||||||||||| ||||||||||| ||||||| | |||||||||||||| | |
|
|
| T |
15814559 |
ttgtgatcaatcaataaacccatcaataagaacggaagtatccttaacagcaataagaacggaagtatcatggataactctatagttgcaaagattcgac |
15814658 |
T |
 |
| Q |
213 |
gtattcttctgatggat |
229 |
Q |
| |
|
|| |||||| ||||||| |
|
|
| T |
15814659 |
gtcttcttcagatggat |
15814675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 139
Target Start/End: Original strand, 16072354 - 16072399
Alignment:
| Q |
94 |
aaatttgtctccatagagattgtgatcaatcaacaaactcatcaat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||| |||||||| |
|
|
| T |
16072354 |
aaatttgtctccatagagattgtgatcaatcgataaaatcatcaat |
16072399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 139
Target Start/End: Original strand, 16086007 - 16086052
Alignment:
| Q |
94 |
aaatttgtctccatagagattgtgatcaatcaacaaactcatcaat |
139 |
Q |
| |
|
||||||||||| |||||||||||||||||| | |||||||||||| |
|
|
| T |
16086007 |
aaatttgtctctatagagattgtgatcaattgataaactcatcaat |
16086052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University