View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_147 (Length: 229)
Name: NF0784_low_147
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_147 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 19581231 - 19581427
Alignment:
| Q |
1 |
ttcaacaaaatttaagctccacaataacaaacatgcatccaaaatattaacaatatattattataaagccatgttattattgatatagcgcagtctgagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19581231 |
ttcaacaaaatttaagctccacaataacaaacatgcatccaaaatattaacaatatatt---ataaagccatgttattattgatatagcgcagtctgagc |
19581327 |
T |
 |
| Q |
101 |
caaacttgtttatacatggtctagataatatttttgggtgagttcatacaagatatatagttaacagtttggacccacattcctcttcaaatgaagatag |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19581328 |
caaacttgtttatacatggtatagataatatttttgggtgagttcatacaagatatatagtcaacagtttggacccacattcctcttcaaatgaagatag |
19581427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University