View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_148 (Length: 224)
Name: NF0784_low_148
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_low_148 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 29 - 178
Target Start/End: Original strand, 31705797 - 31705947
Alignment:
Q |
29 |
ttattattcttctctactaccacttgagtaaccaaaattaataagaacannnnnnnnnnaa--aataatactgattaatggagtgagtagtaaataaatg |
126 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||||||| |
|
|
T |
31705797 |
ttattattcttctctactaccacttgagtaaccaaaattaataagaacattttcttttttataaataatactgattaatggagcgagtagtaaataaatg |
31705896 |
T |
 |
Q |
127 |
aaagaactattaatccaaaaacacattccaccttggagggagtatattgttg |
178 |
Q |
|
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
T |
31705897 |
aaagaactattaatcc-aaaacacattccacctcggagggagtatattgttg |
31705947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University