View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_149 (Length: 221)
Name: NF0784_low_149
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_low_149 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 19140090 - 19140214
Alignment:
Q |
1 |
atgaagtttcattcttttcaactctagtaaaaccttttgcaaagtgtcttatataattaaattattcatataagaaagagtgtaatgtaaatgtaaagtt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19140090 |
atgaagtttcattcttttcaactctagtaaaaccttttgcaaagtgtcttatataattaaattattcatataagaaagagtgtaatgtaaatgtaaagtt |
19140189 |
T |
 |
Q |
101 |
tcttttctaatgaaatttccaaaat |
125 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
19140190 |
tcttttctaatgaaatttccaaaat |
19140214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University