View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_153 (Length: 220)
Name: NF0784_low_153
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_153 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 13 - 158
Target Start/End: Complemental strand, 31705943 - 31705797
Alignment:
| Q |
13 |
aatatactccctccaaggtggaatgtgtttttggattaatagttctttcatttatttactactcactccattaatcagtattatt--ttnnnnnnnnnnt |
110 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| | | |
|
|
| T |
31705943 |
aatatactccctccgaggtggaatgtgtttt-ggattaatagttctttcatttatttactactcgctccattaatcagtattatttataaaaaagaaaat |
31705845 |
T |
 |
| Q |
111 |
gttcttattaattttggttactcaagtggtagtagagaagaataataa |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31705844 |
gttcttattaattttggttactcaagtggtagtagagaagaataataa |
31705797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University