View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0784_low_153 (Length: 220)

Name: NF0784_low_153
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0784_low_153
NF0784_low_153
[»] chr5 (1 HSPs)
chr5 (13-158)||(31705797-31705943)


Alignment Details
Target: chr5 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 13 - 158
Target Start/End: Complemental strand, 31705943 - 31705797
Alignment:
13 aatatactccctccaaggtggaatgtgtttttggattaatagttctttcatttatttactactcactccattaatcagtattatt--ttnnnnnnnnnnt 110  Q
    |||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||  |           |    
31705943 aatatactccctccgaggtggaatgtgtttt-ggattaatagttctttcatttatttactactcgctccattaatcagtattatttataaaaaagaaaat 31705845  T
111 gttcttattaattttggttactcaagtggtagtagagaagaataataa 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
31705844 gttcttattaattttggttactcaagtggtagtagagaagaataataa 31705797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University