View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_158 (Length: 216)
Name: NF0784_low_158
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_158 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 21 - 172
Target Start/End: Complemental strand, 5964972 - 5964817
Alignment:
| Q |
21 |
gaacatagaaccgtctataaaactacttaagagaatgataagtatcttagaattcttgaaataaaatattg----gggggagccctcctcctggaagaga |
116 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
5964972 |
gaacagagaaccgtctataaaactacttaagagaatgataagtatcttagaattcttgaaataaaatattgtggggggggggccctcctcctggaagaga |
5964873 |
T |
|
| Q |
117 |
aaaagggctctgatagggttttgccttagggtttgctctctgccttctgtgctgct |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5964872 |
aaaagggctctgatagggttttgccttagggtttgctctctgccttctatgctgct |
5964817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4832 times since January 2019
Visitors: 5752