View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0784_low_158 (Length: 216)

Name: NF0784_low_158
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0784_low_158
NF0784_low_158
[»] chr6 (1 HSPs)
chr6 (21-172)||(5964817-5964972)


Alignment Details
Target: chr6 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 21 - 172
Target Start/End: Complemental strand, 5964972 - 5964817
Alignment:
21 gaacatagaaccgtctataaaactacttaagagaatgataagtatcttagaattcttgaaataaaatattg----gggggagccctcctcctggaagaga 116  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||| |||||||||||||||||||    
5964972 gaacagagaaccgtctataaaactacttaagagaatgataagtatcttagaattcttgaaataaaatattgtggggggggggccctcctcctggaagaga 5964873  T
117 aaaagggctctgatagggttttgccttagggtttgctctctgccttctgtgctgct 172  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
5964872 aaaagggctctgatagggttttgccttagggtttgctctctgccttctatgctgct 5964817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4832 times since January 2019
Visitors: 5752