View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_159 (Length: 215)
Name: NF0784_low_159
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_low_159 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 48666451 - 48666403
Alignment:
Q |
1 |
gaaaaatgcaaccaagttgaaaaaggcggcggaggaagcagtggcggtt |
49 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48666451 |
gaaaaatgcaaccaagttgaaaaaggcggcggaggaagcagtggcggtt |
48666403 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University