View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_4 (Length: 649)
Name: NF0784_low_4
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 3e-99; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 3e-99
Query Start/End: Original strand, 30 - 213
Target Start/End: Original strand, 35058730 - 35058913
Alignment:
| Q |
30 |
attttgggaagaactgagattgtgcaagctgacacaaaacaatgttatccaagttgtgcggattatgattctggggttgatagtttttcagctccaacta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35058730 |
attttgggaagaactgagattgtgcaagctgacacaaaacaatgttatccaagttgtgcggattatgattctggggttgatagtttttcagctccaacta |
35058829 |
T |
 |
| Q |
130 |
agtacatgatttggagtagtagaatgaatactcatgtttggcctgcatatgttttaagcttcaaggtttcttctttgaaaggtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35058830 |
agtacatgatttggagtagtagaatgaatactcatgtttggcctgcatatgttttaagcttcaaggtttcttctttgaaaggtt |
35058913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 178; E-Value: 1e-95
Query Start/End: Original strand, 312 - 497
Target Start/End: Original strand, 35059011 - 35059196
Alignment:
| Q |
312 |
gtagcagttgagattgaaggatatgggagaccaacttcaccttcggtgccttttccgactttgatttctatgctttccaaggtttcgccacaacttgata |
411 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35059011 |
gtagcggttgagattgaaggatatgggagaccaacttcaccttcggtgccttttccgactttgatttctatgctttccaaggtttcgccgcaacttgata |
35059110 |
T |
 |
| Q |
412 |
ttgccctgatttgcaagttctataaagctagaaaggtaagtgttggttttgcttcctacttgcatattggtttaagagtcttgata |
497 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35059111 |
ttgccctgatttgcaagttctataaagctagaaaggtaagtgttggttttgcttcctacttgcatattggtttaagagtcttgata |
35059196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 110; E-Value: 4e-55
Query Start/End: Original strand, 531 - 640
Target Start/End: Original strand, 35059230 - 35059339
Alignment:
| Q |
531 |
atcacttgctctatttcttgcaggaaaagaagatttcccgacatgaattgatagaaaaagtgagacaaattgcaggagacaagttgctgttttcaatcat |
630 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35059230 |
atcacttgctctatttcttgcaggaaaagaagatttcccgacatgaattgatagaaaaagtgagacaaattgcaggagacaagttgctgttttcaatcat |
35059329 |
T |
 |
| Q |
631 |
taagtattat |
640 |
Q |
| |
|
|||||||||| |
|
|
| T |
35059330 |
taagtattat |
35059339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 551 - 624
Target Start/End: Original strand, 43897918 - 43897991
Alignment:
| Q |
551 |
caggaaaagaagatttcccgacatgaattgatagaaaaagtgagacaaattgcaggagacaagttgctgttttc |
624 |
Q |
| |
|
||||| ||||||||||| ||||||||| ||||| ||||||| ||| || ||||||| ||||| ||| ||||||| |
|
|
| T |
43897918 |
caggataagaagatttcgcgacatgaaatgatacaaaaagttagaaaagttgcaggtgacaaattgttgttttc |
43897991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University