View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_53 (Length: 358)
Name: NF0784_low_53
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 30 - 349
Target Start/End: Complemental strand, 43970510 - 43970178
Alignment:
| Q |
30 |
gaaaaaactgagcatgaaagcatgcatcattgaaatttcggcaacatttatccctgaaagaatccagaatggaatgataaaataattagagtgtgagaag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43970510 |
gaaaaaactgagcatgaaagcatgcatcattgaaatttcggcaacatttatccc-gaaagaatccagaatggaatgataaaataattagagtgtgagaag |
43970412 |
T |
|
| Q |
130 |
aaaccattgggagaatgggaaaataaatacgatgaatcaaagtgacaactctataattaggaatcattgtaattagtgtgtgagattaagtgagagattg |
229 |
Q |
| |
|
|||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43970411 |
aaactattggaagaatggaaaaataaatacgatgaatcaaagtgacaactctataattaggaatcattgtaattagtgtgtgagattaagtgagagattg |
43970312 |
T |
|
| Q |
230 |
gaagcaaacaatgtgagaattccttaaagaaatagggaatcaga-gattgt---------------accgtcaacgtagctttgtagtgtgtcgttcatt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
43970311 |
gaagcaaacaatgtgagaattccttaaagaaatagggaatcagaggtttgtaccgtcaacaatgcaaccgtcaacgtagctttgtagtgcgtcgttcatt |
43970212 |
T |
|
| Q |
314 |
ggccaccacagtctccttctttacttacgtctctct |
349 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| |
|
|
| T |
43970211 |
ggccac--cagtctccttctttatttacgtctctct |
43970178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6372 times since January 2019
Visitors: 5768