View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_56 (Length: 357)
Name: NF0784_low_56
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 30 - 316
Target Start/End: Original strand, 40336197 - 40336483
Alignment:
| Q |
30 |
tattaagcaatttggtgaagcaaccttaagcaatttggaaaatgtaccatattaagaaactttaaagcttgctatattttgtttaggataatagtgctat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40336197 |
tattaagcaatttggtgaagcaaccttaagcaatttggaaaatgtaccatattaagaaactttaaagcttgctatattttgtttaggataatagtgctat |
40336296 |
T |
|
| Q |
130 |
ttgtacacctaatactaacggtttttagnnnnnnnnnnggtctaacggtttttacttttagtctacaaattaatttataaatccttttcctgaaatttca |
229 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40336297 |
ctgtacacctaatactaacggtttttttttttttttttggtctaacggtttttacttttagtctacaaattaatttataaatccttttcctgaaatttca |
40336396 |
T |
|
| Q |
230 |
agaaatgtggctttcctgaaattccaagaaatatggcatggcaatgggagagtcacacaatggagttttagcatatcacgtgatatt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40336397 |
agaaatgtggctttcctgaaattccaagaaatgtggcatggcaatgggagagtcacacaatggagttttagcatatcacgtgatatt |
40336483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7093 times since January 2019
Visitors: 5774