View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_62 (Length: 327)
Name: NF0784_low_62
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0784_low_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 19581255 - 19581030
Alignment:
Q |
1 |
attgtggagcttaaattttgttgaaccatcatcgagagcttaattagatgttctgtattgcaaattatcgttgttctctactgtgctccagcaatgtcga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19581255 |
attgtggagcttaaattttgttgaaccatcatcgagagcttaattagatgttctgtattgcaaattatcgttgttctctactgtgctccagcaatgtcga |
19581156 |
T |
 |
Q |
101 |
ctatcggttgatgttcacttccgatcagtacataaaaggaaaaacagatggattctttttaacatttttagttttcaaggtagagattcaaacacataaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
19581155 |
ctatcggttgatgttcacttccgatcagtacataaaaggaaaaatagatggattctttttaacatttttagttttcaaggtagagattcaaacacattaa |
19581056 |
T |
 |
Q |
201 |
tgcaatttgagggatattattcgaca |
226 |
Q |
|
|
||||||||||||||||||||| |||| |
|
|
T |
19581055 |
tgcaatttgagggatattatttgaca |
19581030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6468 times since January 2019
Visitors: 5768