View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_63 (Length: 326)
Name: NF0784_low_63
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_63 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 91 - 254
Target Start/End: Original strand, 37574451 - 37574618
Alignment:
| Q |
91 |
gatatatcatatagtcatgtggacatatgaattgaacaaacacatgaattgagtgagcgcgtgtattagcatcgcactcttcacacgtaggggtagcta- |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
37574451 |
gatatatcatatagtcatgtggacatatgaattgaacaaacacatgaattgagtgagcgcgtgtattagcattgcgctcttcacacgtaggggtagctag |
37574550 |
T |
 |
| Q |
190 |
---gattaatctgatgatgcatgaggatgaggccaatacaaccaaatttactatacaataccctctct |
254 |
Q |
| |
|
||| ||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37574551 |
agtgatgaatttgatgatgcatgaggatgaggccaatacaaccaaatttacaatacaataccctctct |
37574618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 95 - 132
Target Start/End: Complemental strand, 32970234 - 32970197
Alignment:
| Q |
95 |
tatcatatagtcatgtggacatatgaattgaacaaaca |
132 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
32970234 |
tatcatacagtcatatggacatatgaattgaacaaaca |
32970197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University