View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_64 (Length: 326)
Name: NF0784_low_64
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 103 - 291
Target Start/End: Complemental strand, 44619565 - 44619377
Alignment:
| Q |
103 |
aaaagatcgccgctttcaatccatgaaacatatgatataatactttttgtccttgttatagttttagtcttatagtattttatctattttggaattaatc |
202 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44619565 |
aaaagatcgccgttttcaatccatgaaacatatgatataatattttttgtccttgttttagttttagtcttgtagtattttatctattttggaattaatc |
44619466 |
T |
|
| Q |
203 |
tttctaatatggggaccatgtttatttaaatctctggaatctggcattttgtgatgatctaattgaaagtatattctctttgtcggtct |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44619465 |
tttctaatatggggaccatgtttatttaaatctctggaatctggcatcttgtgatgatctaattgaaagtatattctctttgtcagtct |
44619377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7119 times since January 2019
Visitors: 5774