View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0784_low_65 (Length: 325)
Name: NF0784_low_65
Description: NF0784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0784_low_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 7e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 80 - 189
Target Start/End: Original strand, 3741180 - 3741289
Alignment:
| Q |
80 |
agaaatgaaacaacgttaaaactcttggagaaaatttaccgcctatttcgattatacaaaattcaagagattagtttccgcagttacgtacagaggatgt |
179 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3741180 |
agaaatgaagcaacgttaaaactcttggagaaaatttaccgcctatttcaattatacaaagttcaagagattagtttctgcagttacgtacagaggatgt |
3741279 |
T |
 |
| Q |
180 |
ctagtttaga |
189 |
Q |
| |
|
|||||||||| |
|
|
| T |
3741280 |
ctagtttaga |
3741289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 234 - 325
Target Start/End: Original strand, 3741336 - 3741427
Alignment:
| Q |
234 |
ttcaccaagaggtgttagtaggcacaactttatttaattgacaaattattcctaatcaacactcttgatgaagacaatttttctaggtacct |
325 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3741336 |
ttcaccaagaggtgttggtaggcacaactttatttaattgacaaattattcctaatcaacactcttgatgaagacaatttttctaggtacct |
3741427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University